View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_74 (Length: 239)
Name: NF10041_low_74
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_74 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 31413286 - 31413177
Alignment:
| Q |
3 |
gcctggaacatatcagccattgattgctttttaacgcttgattacacacacatcaatgctagatgttaatgctgggttaattgcatttactcttatttga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31413286 |
gcctggaacatatcagccattgattgctttttaacgcttgattacacacacatcaatgctagatgttaatgctgggttaattgcatttactcttatttga |
31413187 |
T |
|
| Q |
103 |
cttacacggt |
112 |
Q |
| |
|
||| |||||| |
|
|
| T |
31413186 |
cttgcacggt |
31413177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 38014447 - 38014556
Alignment:
| Q |
1 |
gcgcctggaacatatcagccattgattgctttttaacgcttgattacacacacatcaatgctagatgttaatgctgggttaattgcatttactcttattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
38014447 |
gcgcctggaacatatcagccattgattgctttttaacgcttgatt--acacacatcaatgctagatgttaatgctgggttgattgcatttattgttattt |
38014544 |
T |
|
| Q |
101 |
gacttacacggt |
112 |
Q |
| |
|
||||| |||||| |
|
|
| T |
38014545 |
gacttgcacggt |
38014556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University