View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_77 (Length: 237)
Name: NF10041_low_77
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10041_low_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 46630935 - 46631154
Alignment:
Q |
5 |
ggagaagcagagatggagttttagaagatcatcagcaacagctacaccaacagcttccaaggaattgaataattctgaaattactgcttcaatgacagtg |
104 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46630935 |
ggagaagaagagatggagttttagaagatcatcagcaacagctacaccaacagcttccaaggaattgaataattctgaaattactgcttcaatgacagtg |
46631034 |
T |
 |
Q |
105 |
caaagtactgtcattgatattcagaatgagcaaaggaatcatgccattgctgtggctgctgcgacagccgcggcagctgatgcagcagtggcagctgcac |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
46631035 |
caaagtactgtcattgatattcagaatgagcaaaggaatcatgccattgctgtggctgctgctacagccgcggcagctgatgcagcagtggcagctgcac |
46631134 |
T |
 |
Q |
205 |
aagctgcagctgctgagatc |
224 |
Q |
|
|
||||||||||||||| |||| |
|
|
T |
46631135 |
aagctgcagctgctgtgatc |
46631154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University