View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10041_low_88 (Length: 225)

Name: NF10041_low_88
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10041_low_88
NF10041_low_88
[»] chr3 (1 HSPs)
chr3 (1-202)||(52676871-52677072)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 52676871 - 52677072
Alignment:
1 aagaagttggtgatttgagaaggaacttattcccaacgccnnnnnnnnnnnnngttggaagcacttttgaaggtgcacctagagagcaacaagctttgct 100  Q
    ||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||||||||||||    
52676871 aagaagttggtgatttgagaaggaacttattcccaacgcctttttcgttttttgttggaagcacttttgaaggtgcacctagagagcaacaagctttgct 52676970  T
101 ggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaacacgcttaattatctatctgctgcttctgccgttaaagatgttttt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
52676971 ggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaatacgcttaattatctatctgctgcttctgccgttaaagatgttttt 52677070  T
201 cc 202  Q
    ||    
52677071 cc 52677072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University