View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_91 (Length: 212)
Name: NF10041_low_91
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_91 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 10279108 - 10278932
Alignment:
| Q |
1 |
ctttaattcaataatggacctatgattcacagtgaaactgtacgaacatatcgacactgtgactgactgaacacatataatggaagatac--ttttttgg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||| ||| ||||| |||||||| | |||||||| |
|
|
| T |
10279108 |
ctttaattcaataatggacctatgattcacaccgaaactgtacgaacatatcgaaactgtgagtga----acagatatattggaagatgcatttttttgg |
10279013 |
T |
|
| Q |
99 |
accaattatatgagaaaacaatatacggagttacttctttgtaataattatatgcacctatgtcttctatatttattgctt |
179 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| | |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10279012 |
accaattatatgagaaaacaatatatggagttacttgtctgtaataactatatgcacctatgtcttctatatttattgctt |
10278932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University