View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10042_low_14 (Length: 247)
Name: NF10042_low_14
Description: NF10042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10042_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 103 - 203
Target Start/End: Original strand, 29045175 - 29045270
Alignment:
| Q |
103 |
gagtacttgcatatatatatagtcttcaaagtttcaatctttggatgaaatacgttgcttgactttaaatatttatgttcatcatcatacagaaactagt |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29045175 |
gagtacttgcatgtatatatagtcttcaaagtttcaatctttggatgaaatacgttgcttcactttaaatattgatg-----catcatacagaaactagt |
29045269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 29045094 - 29045131
Alignment:
| Q |
18 |
atacgtttcatctaccttctcctcttcacttgttgctc |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29045094 |
atacgtttcatctaccttctcctcttcacttgttgctc |
29045131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University