View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10044_1 (Length: 636)
Name: NF10044_1
Description: NF10044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10044_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 179 - 511
Target Start/End: Complemental strand, 9248827 - 9248496
Alignment:
| Q |
179 |
gatatattcaagcaacaatgcttcaagacaatttacaaaaggatccaacaacaatcatcacaaccagtttgcaatattggatatagttatggctgctctt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9248827 |
gatatattcaagcaacaatgcttcaagacaatttacaaaaggatccaacaacaatcatcaaaaccagtttgcaatattggatatagttatggctgctctt |
9248728 |
T |
 |
| Q |
279 |
aagaaatctattgtaacttgcagtgtggagagggaggatgtttcttccttagatattagctggccaactgaagtgagacacgtgtcacatgttacttttg |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9248727 |
aagaaatctattgtaacttgcagtgtggagagggaggatgtttcttccttagatattagctggccaactgaagtgagacacgtgtcacatgttacttttg |
9248628 |
T |
 |
| Q |
379 |
atagattcaatggttttcttggtttgccttctgagtttcagcctgaggttcctacaagggtacctagtgccaggtcaattttttatatctctgctcctcc |
478 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |
|
|
| T |
9248627 |
atagattcaatggttttcttggtttgccttctgagtttcagcctgaggttcctacaagggtacctagtgccaggtcaattttttatatctct-attgttc |
9248529 |
T |
 |
| Q |
479 |
tcagaacatgaaatttatgtaatttggttcaat |
511 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |
|
|
| T |
9248528 |
ttagaacatgaaatttatgtaatttggttcaat |
9248496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 9249002 - 9248924
Alignment:
| Q |
1 |
tgactcgcctttttcgatcgaaatcatgcaacatagctggtttcagtgtgtctgaattcaaccctgctgcacaagtaac |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9249002 |
tgactcgcctttttcgatcgaaatcatgcaacatagctggtttcagtgtgtctgaattcaaccctgctgcacaagtaac |
9248924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University