View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10044_2 (Length: 622)
Name: NF10044_2
Description: NF10044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10044_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 552 - 609
Target Start/End: Complemental strand, 41519468 - 41519411
Alignment:
| Q |
552 |
ttttggagttaaagaagttaaaggaaaagtggttagatgatagtgatgctcttgatga |
609 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41519468 |
ttttggagttggagaagttgaaggaaaagtggttagatgatagtaatgctcttgatga |
41519411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 552 - 609
Target Start/End: Complemental strand, 41509248 - 41509191
Alignment:
| Q |
552 |
ttttggagttaaagaagttaaaggaaaagtggttagatgatagtgatgctcttgatga |
609 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
41509248 |
ttttggagttggagaagttgaaggaaaagtggctagatgatagtactgctcttaatga |
41509191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 252 - 297
Target Start/End: Complemental strand, 17349309 - 17349264
Alignment:
| Q |
252 |
ggggtcacgcgagcttaaaatgggcttaaagaccaagtaaaaacta |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17349309 |
ggggtcacgcgagcttaaaatgggcttaaagaccaagcaaaaacta |
17349264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University