View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_high_1 (Length: 373)
Name: NF10045_high_1
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 6 - 363
Target Start/End: Complemental strand, 16846296 - 16845939
Alignment:
| Q |
6 |
aagattctgttgaagctcttcccaatcacacgtgttgttatgaggacaaggcgtaaacgttctgagtttggtgtaaccatcgttgaagccaccggtttgg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16846296 |
aagattctgttgaagctcttcccaatcacacgtgttgttatgaggacaaggggtaaacgttctgagtttggtgtaaccatcgttgaagccaccggtttgg |
16846197 |
T |
|
| Q |
106 |
attagggttccggtgggagagactgcaccggaggaacaccaagcgtcggtttgtagggttaaaggacggagggtgttggtggtgatgtcgtagagaatgg |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16846196 |
attagggttccggtgggggagactgcaccggaggaacaccaagcgtcggtttgtagggttaaaggacggagggtgttggtggtgatgtcgtagaggatgg |
16846097 |
T |
|
| Q |
206 |
agtgagctgtgcagtcgagtttgagagccatgtcatgagggttgtaacggcaacggttgttggagagagagatgttggagggaccgaaatcggttcggtc |
305 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16846096 |
agtgagcggtgcagtcgagtttgagagccatgtcgtgagggttgtaacggcaacggttgttggagagggagatgttggagggaccgaaatcggttcggtc |
16845997 |
T |
|
| Q |
306 |
gaagatgattactttgttgtctttcattacttgcatgtgcatggctgagatgcctatg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16845996 |
gaagatgattactttgttgtctttcattacttgcatgtgcatggctgagatgcctatg |
16845939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 82 - 146
Target Start/End: Complemental strand, 52913319 - 52913255
Alignment:
| Q |
82 |
ccatcgttgaagccaccggtttggattagggttccggtgggagagactgcaccggaggaacacca |
146 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||| ||||| ||| | ||||||||||||||| |
|
|
| T |
52913319 |
ccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacacca |
52913255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University