View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_high_7 (Length: 267)
Name: NF10045_high_7
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 8886552 - 8886789
Alignment:
| Q |
13 |
gagatataagagtggcagacaagttgcgagattccacgacaagacggtaggtagggatagaaatattagagaagcagctagaattttgatttctccaaaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8886552 |
gagatttaagagtggcagacaagttgcgagcttccacgacaagacggtaggtagggatagaaatattagagaagcagctagaattttgatttctccaaga |
8886651 |
T |
|
| Q |
113 |
ccaccacactcctacggcgaagatattggaagattgggaggtgagtctttgcctaagccaacacaaagcatctgtgttagagaaaaactcaacagagctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8886652 |
ccaccacactcctacggcgaagatattggaagattgggaggtgagtccttgcctaagccaacacaaagcatctgtgttagagaaaaactcaacaaagctg |
8886751 |
T |
|
| Q |
213 |
aagcccatagcatgccagaggttggtggaggttgtgca |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8886752 |
aagcccagagcatgccagaggttggtggaggttgtgca |
8886789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 47403034 - 47402963
Alignment:
| Q |
14 |
agatataagagtggcagacaagttgcgagattccacgacaagacggtaggtagggatagaaatattagagaa |
85 |
Q |
| |
|
||||||||| |||||||| ||||| |||| ||| | | |||||||||||||||||||||||||||||||||| |
|
|
| T |
47403034 |
agatataagggtggcagataagttacgagcttctatggcaagacggtaggtagggatagaaatattagagaa |
47402963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 56 - 115
Target Start/End: Original strand, 22203077 - 22203136
Alignment:
| Q |
56 |
acggtaggtagggatagaaatattagagaagcagctagaattttgatttctccaaaacca |
115 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
22203077 |
acggtaggtagagatcctaatattagagaagcagttagaattttggtttctccagaacca |
22203136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 119
Target Start/End: Complemental strand, 27583765 - 27583667
Alignment:
| Q |
21 |
agagtggcagacaagttgcgagattccacgacaagacggtaggtagggatagaaatattagagaagcagctagaattttgatttctccaaaaccaccac |
119 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||| |||| ||| || ||||| |||| |||| ||||| | ||||||||| |||||||| |
|
|
| T |
27583765 |
agagtggcagacaagttgcaggcttccacgacaagatggtatgtagagatcaaagtattaaagaaatagctggaattcttgtttctccaagaccaccac |
27583667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 226
Target Start/End: Complemental strand, 27583623 - 27583563
Alignment:
| Q |
166 |
taagccaacacaaagcatctgtgttagagaaaaactcaacagagctgaagcccatagcatg |
226 |
Q |
| |
|
||||||||| ||||||| ||| |||||||||||||||| | || ||||||||| |||||| |
|
|
| T |
27583623 |
taagccaactcaaagcacctggattagagaaaaactcaataaagatgaagcccaaagcatg |
27583563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University