View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_13 (Length: 250)
Name: NF10045_low_13
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_13 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 37809333 - 37809569
Alignment:
| Q |
14 |
agatgttcttaattgaatctgtattgtaattgtatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttatgactc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809333 |
agatgttcttaattgaatctgtattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttatgactc |
37809432 |
T |
 |
| Q |
114 |
t--tgtatagaaaacataacacaacaaacaactaactgccgaactccctaactgtcagccgcttagaaaagttggttagaatgcaatcagttagttacac |
211 |
Q |
| |
|
| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809433 |
tcttatatagaaaacataacacaa--aacaactaactgccgaactccctaactgtcagccgtttagaaaagttggttagaatgcaatcagttagttacac |
37809530 |
T |
 |
| Q |
212 |
agggtcattatctcctctttacctcttatcattctatgc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809531 |
agggtcattatctcctctttacctcttatcattctatgc |
37809569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 35 - 108
Target Start/End: Complemental strand, 37646453 - 37646380
Alignment:
| Q |
35 |
tattgtaattgtatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttat |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37646453 |
tattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttctagtaaccttat |
37646380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 35 - 108
Target Start/End: Original strand, 37814390 - 37814463
Alignment:
| Q |
35 |
tattgtaattgtatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttat |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37814390 |
tattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttctagtaaccttat |
37814463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University