View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_17 (Length: 242)
Name: NF10045_low_17
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_17 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 13389 - 13165
Alignment:
| Q |
1 |
ccctttcacatccaatactattgggtttagcgagtggttaattatgtggatgacctgaatggataaactctgatatcatattagattttttatattgtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13389 |
ccctttcacatccaatactattgggtttagcgactggttaattctgtggatgacccgaatggataaactctgatatcatattagattttttatattgtat |
13290 |
T |
 |
| Q |
101 |
ataattctaactctttattacaatccgacttataaggtgagatgtgccactctttataagctcttttccgacgttatcaattttcgatgtgagatttgag |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13289 |
ataattctaactctttattacaaaccgacttataaggtgagatgtgccactctttataagctcttttccgacgttatcaattttcgatgtgagatttgag |
13190 |
T |
 |
| Q |
201 |
ttgttttcaatacgactgtcctgag |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
13189 |
ttgttttcaatacgactgtcctgag |
13165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University