View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_18 (Length: 240)
Name: NF10045_low_18
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 25 - 225
Target Start/End: Original strand, 33268890 - 33269090
Alignment:
| Q |
25 |
atgaattgtgtatttggatgtccgatggtccgtcatcaaacgtgcgtctagttgaagttacatgaggtagcttttgatttgcggtgagtttccacattcc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33268890 |
atgaattgtgtatttggatgtccgatggtccgtcatcaaacgtgcgtctagttgaagttacatgaggtagcttttgatttgcggtgagtttccacgttcc |
33268989 |
T |
 |
| Q |
125 |
aaacacacgaaatcggtctctaaaaattgttagtactttaattttttcttttcagaattttctttagtacttcacttcaattattatagaagtgaattct |
224 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33268990 |
aaacacacgaaatcggtctctaaaatttgttagtactttaattttttcttttcagaattttctttagtacttcacttcaattattctagaagtgaattct |
33269089 |
T |
 |
| Q |
225 |
g |
225 |
Q |
| |
|
| |
|
|
| T |
33269090 |
g |
33269090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University