View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_20 (Length: 233)
Name: NF10045_low_20
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 38588075 - 38588284
Alignment:
| Q |
14 |
attacaagttatgacactcaacatatttataaatacttaccaaaagtggcagtttgcattgtcttaacgccgtcgacgaagtttttgtgaccagtgataa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38588075 |
attacaagttatgacactcaacatatttataaatacttaccaaaagtggcagtttgcattgtcttaacgccgtcgacgaagtttttgtgaccagtgataa |
38588174 |
T |
|
| Q |
114 |
tggactttgtaggaccgtcgccatacataagaatatttattgatgttttgggaatggtgatgtactcgtcatagaccccagccttgacatagataatgta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38588175 |
tggactttgtaggaccgtcgccatacataagaatatttattgatgttttgggaatggtgatgtactcgtcatagaccccagccttgacatagataatgta |
38588274 |
T |
|
| Q |
214 |
tctgcctttg |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
38588275 |
tctgcctttg |
38588284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 223
Target Start/End: Original strand, 45294212 - 45294275
Alignment:
| Q |
160 |
tttgggaatggtgatgtactcgtcatagaccccagccttgacatagataatgtatctgcctttg |
223 |
Q |
| |
|
||||||||| |||||||| || |||||||| |||||||| || |||||| | |||||||||||| |
|
|
| T |
45294212 |
tttgggaatagtgatgtattcatcatagacgccagccttaacgtagatagtatatctgcctttg |
45294275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 223
Target Start/End: Original strand, 45303172 - 45303235
Alignment:
| Q |
160 |
tttgggaatggtgatgtactcgtcatagaccccagccttgacatagataatgtatctgcctttg |
223 |
Q |
| |
|
||||||||| |||||||| || |||||||| |||||||| || |||||| | |||||||||||| |
|
|
| T |
45303172 |
tttgggaatagtgatgtattcatcatagacgccagccttaacgtagatagtatatctgcctttg |
45303235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University