View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_23 (Length: 227)
Name: NF10045_low_23
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_23 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 13607 - 13381
Alignment:
| Q |
1 |
ttggaaaagagggaagtaggaactaagttagctactgcattagcaagaaacaaatcagaggtaagaacactgcatcatgaagaaatagannnnnnnagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13607 |
ttggaaaagagggaagtaggaactaagttagctactgcattagcaagaaacaaatcagaggtaagaacactgcatcatgaagaaatagatttttttagtt |
13508 |
T |
 |
| Q |
101 |
cattattctcatgttcattaatatgggacttggattattccgaatataccatcttaaattattaaaatatttaaaacttatctgtttttaatatggtact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13507 |
cattattctcatgttcattaatatgggacttggattattccgaatataccatcttaaattattaaaatatttaaaacttatctgtttttaatatggtact |
13408 |
T |
 |
| Q |
201 |
tcgattttgttcgatataccctttcac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
13407 |
tcgattttgttcgatataccctttcac |
13381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University