View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_25 (Length: 227)
Name: NF10045_low_25
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 69 - 193
Target Start/End: Complemental strand, 50633576 - 50633451
Alignment:
| Q |
69 |
ctactatatattagataaaactcaaaatattgtctaaagaataaagtgtgattaacctaaaagcatctttcaa-aaaacaaaactattagagcacctacc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
50633576 |
ctactatatattagataaaactcaaaatattatctaaagaataaagtgtgattaacctaaaagcagctttcaaaaaaacaaaactattagagcacctacc |
50633477 |
T |
|
| Q |
168 |
atttcattccaaatataacatgatag |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
50633476 |
atttcattccaaatataacatgatag |
50633451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 185 - 227
Target Start/End: Complemental strand, 50632887 - 50632845
Alignment:
| Q |
185 |
acatgatagtagtgtctttgttcaagatttgctgaatatgttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632887 |
acatgatagtagtgtctttgttcaagatttgctgaatatgttt |
50632845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University