View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_28 (Length: 213)
Name: NF10045_low_28
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10045_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 12356109 - 12356299
Alignment:
Q |
22 |
accactatctctctttcataggtctgagttcatccgtcgaccaccagccactggagacgcacctgttctgttcaacctctctcacaacatgcgcctcacg |
121 |
Q |
|
|
||||| |||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12356109 |
accacaatctctctttcacaggtctgagttcatccgccgaccaccagccactagagacgcacctgttctgttcaacctctctcacaacatgcgcctcacg |
12356208 |
T |
 |
Q |
122 |
caattcaattgcagacaaccaacatagtcttccaccttc-accccccaccgatgagaagatctcacgatctactgtttcaatctacagtct |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
T |
12356209 |
caattcaattgcagacaaccaacatagtcttccaccttctcccccccaccgatgagaagatctcacaatctactgtttcgatctacagtct |
12356299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 197
Target Start/End: Complemental strand, 9397867 - 9397833
Alignment:
Q |
163 |
cccccaccgatgagaagatctcacgatctactgtt |
197 |
Q |
|
|
|||||||||| |||||||||||||||||||||||| |
|
|
T |
9397867 |
cccccaccgacgagaagatctcacgatctactgtt |
9397833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University