View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_4 (Length: 336)
Name: NF10045_low_4
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 326
Target Start/End: Complemental strand, 34956697 - 34956390
Alignment:
| Q |
18 |
ctaaggtatagagctttgcgtttgattatgcggcgtgcgttgtcgtcggagagaggctttttagggtggatgtatggtggttttggttttgttgggtcgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956697 |
ctaaggtatagagctttgcgtttgattatgcggcgtgcgttgtcgtcggagagaggctttttagggtggatgtatggtggttttggttttgttgggtcgg |
34956598 |
T |
 |
| Q |
118 |
tggttctgggggaccatgggtcgcgctgtacttggctgcgaataatgggtttgtccttcttcttcggtaacaatggtgtggagaatagaaacgaggattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956597 |
tggttctgggggaccatgggtcgcgctgtacttggctgcgaataatgggtttgttcttcttcttcggtaacaatggtgtggagaatagaaacgaggattt |
34956498 |
T |
 |
| Q |
218 |
caaacactccatttgtagtgtttaaacttcaaattctacgactgggttgttttcgagtacaaatgtggatttatccagaccataaattttactatgtcat |
317 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
34956497 |
caaacactcca-ttgtagtgtgtaaacttcaaattctacgactgggttgttttcgagtacaaatgtggatttatccagaccataaactttattatgtcat |
34956399 |
T |
 |
| Q |
318 |
tgctctgtg |
326 |
Q |
| |
|
|||| |||| |
|
|
| T |
34956398 |
tgctttgtg |
34956390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University