View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10045_low_5 (Length: 313)
Name: NF10045_low_5
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10045_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 154 - 290
Target Start/End: Complemental strand, 50632421 - 50632282
Alignment:
| Q |
154 |
tagctcaccgaccaaactaccttaaatagcagccaagtgaaaacattggtcattcattcattcaacaaaaacaaacac---actcttgaattctagttga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
50632421 |
tagctcaccgaccaaactaccttaaatagcagccaagtgaaaacattggtcattcattcattccacaaaaacaaacacactactcttgaattgtagttga |
50632322 |
T |
 |
| Q |
251 |
aagagaaaatgaagaaaacatcaacttgtgtgtccttttt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632321 |
aagagaaaatgaagaaaacatcaacttgtgtgtccttttt |
50632282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 50632607 - 50632529
Alignment:
| Q |
1 |
ttaaccttaaaatcactatgtcgactcaaagcccatggttacaaaaagcaacaaacaacttacatgtgacaacaataat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632607 |
ttaaccttaaaatcactatgtcgactcaaagcccatggttacaaaaagcaacaaacaacttacatgtgacaacaataat |
50632529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University