View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10046_high_7 (Length: 321)
Name: NF10046_high_7
Description: NF10046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10046_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 311
Target Start/End: Complemental strand, 610387 - 610095
Alignment:
Q |
19 |
gttttatccttttagatttcaatatcaaatggctgcaattgtttgccacggtttaccttcatgtcatgattctcaccttgttgagtcaaggtttcataat |
118 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
610387 |
gttttatccttttagatttcaataccaaatggctgcaattgtttgccacggtttaccttcatgtcatgattctcaccttgttgagtcaaggtttcataat |
610288 |
T |
 |
Q |
119 |
attcgtttaccttccccaaaaccactcaccactcaacccattgatttacctttcaagacttgtttttgggatttcgaaaacaacattaataaaactgaaa |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
610287 |
attcgtttaccttccccaaaaccactcaccactcaacccattgatttacctttcaagacttgtttttgggatttcgaaaacaacattaataaaactataa |
610188 |
T |
 |
Q |
219 |
ctgttgattctaatcccaaagaagatagttggagttccattcaatcactttccaaatccaatgcttctaaaggccttaaagaaactacctatg |
311 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
610187 |
ctgttgattctaatcccaaagaagatagctggagttccattcaatcacttttcaaatccaatgcttctaaaggccttaaagaaactacctatg |
610095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University