View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10046_low_14 (Length: 250)
Name: NF10046_low_14
Description: NF10046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10046_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 29965966 - 29965725
Alignment:
| Q |
1 |
tacatgatcatcaggactgtagacagtataatatgattcagtggttggttaaatcttccatctacaaaaagtatttgaaggtgctgctgccgattttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29965966 |
tacatgatcatcaggactgtagacagtataatatgattcagtggttggttaaatcttccatctacaaaaagtatttgaaggtgctgctgccgattttgag |
29965867 |
T |
|
| Q |
101 |
ttttgacacatggtgtcaacgaatcttgatttcatgtgtcagtatctatgttatttctatccatttaaagatctctatcctccttgcagataccgaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29965866 |
ttttgacacatggtgtcaacgaatcttgatttcgtgtgtctgtatctatgttatttctatccatttaaagatctctatcctccttgcagataccgaatca |
29965767 |
T |
|
| Q |
201 |
gccaaagcatcaagacagcagcttaaagaagcaatctgtgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29965766 |
gccaaagcatcaagacagcagcttaaagaagcaatctgtgct |
29965725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 235
Target Start/End: Original strand, 2316065 - 2316113
Alignment:
| Q |
187 |
cagataccgaatcagccaaagcatcaagacagcagcttaaagaagcaat |
235 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
2316065 |
cagatactgaatcagccagagcatcgagacagcaacttaaagaagcaat |
2316113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University