View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10046_low_18 (Length: 244)
Name: NF10046_low_18
Description: NF10046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10046_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 144 - 237
Target Start/End: Original strand, 43178876 - 43178969
Alignment:
| Q |
144 |
atgcaactttaccggtgaacgaatttgcccacattttgtgtattttgcaaaaggtggtgtgagaatcaaaatatacatgtgtccatataaattg |
237 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43178876 |
atgcaactttaccagtgaacgaatttgcccacattttgtgtattttgcaaaaggtggtgtgagaatcaaaatatacacgtgtccatataaattg |
43178969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 166 - 224
Target Start/End: Original strand, 43173024 - 43173082
Alignment:
| Q |
166 |
atttgcccacattttgtgtattttgcaaaaggtggtgtgagaatcaaaatatacatgtg |
224 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43173024 |
atttgcccacattttgtatgttttgcaaaaggtggtgtgagaataaaaatatacatgtg |
43173082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 77
Target Start/End: Original strand, 43178767 - 43178809
Alignment:
| Q |
35 |
cttactaatgttttttctatctatcatatcatttatttaacat |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43178767 |
cttactaatgttttttctatctatcatatcatttatttaacat |
43178809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University