View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10046_low_21 (Length: 219)
Name: NF10046_low_21
Description: NF10046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10046_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 116 - 209
Target Start/End: Original strand, 39164714 - 39164807
Alignment:
| Q |
116 |
ggcatatctttaagaattccatcccttgcactccttgaagcctaaatgtatcagttgaactgctacttccgatcacaacccaaccttcatctct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39164714 |
ggcatatctttaagaattccatcccttgcactccttgaagcctaaatgtatcagttgaactgctacttccgatcacaacccaaccttcctctct |
39164807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 74
Target Start/End: Original strand, 39164661 - 39164716
Alignment:
| Q |
19 |
aaagagtgactgcaatgccctgcaagaaaaggagggtctaggaagtttcttggggc |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39164661 |
aaagagtgactgcaatgccctgcaagaaaaggagggtctaggaagtttcttggggc |
39164716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University