View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10047_low_18 (Length: 250)
Name: NF10047_low_18
Description: NF10047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10047_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 15176350 - 15176114
Alignment:
| Q |
1 |
atggtttagcattgttgcacttggaatactttgttgccaattttgttttgaattttgagtggaaagttgtggatggaaatgagattgatttgtcagaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15176350 |
atggtttagcattgttgcacttggaatactttgttgccaattttgttttgaattttgagtggaaagttgtggatggaaatgagattgatttgtcagaaat |
15176251 |
T |
 |
| Q |
101 |
gcttcaattcacaactgtcatgaagaaccctttgaaggttcatctaatgcctaggttttagttatttttagaaccaattatccatagataaatcttgatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15176250 |
gcttcaattcacaactgtcatgaagaaccctctaaaggttcatctaatatctaggttttagttatttttagaaccaattatccatagataaatcttgatt |
15176151 |
T |
 |
| Q |
201 |
tcatgttttgaattgtgttccagattgtatggcccct |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15176150 |
tcatgtttcgaattgtgttccagattgtatggcccct |
15176114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 26494968 - 26495008
Alignment:
| Q |
24 |
gaatactttgttgccaattttgttttgaattttgagtggaa |
64 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
26494968 |
gaatactttgttgctaatttggttttgaactttgagtggaa |
26495008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University