View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10047_low_20 (Length: 243)
Name: NF10047_low_20
Description: NF10047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10047_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 15176389 - 15176613
Alignment:
| Q |
1 |
atctttatctctttactccccattatatcgaaagtgctattattgataaacctctccggcttaaatgccataggatcatcccaagccgaaaaatctctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15176389 |
atctttatctctttactccccattatatcgaaagtactattattgataaacctctccggtttaaatgccataggatcatcccaagccgaaaaatctctcc |
15176488 |
T |
|
| Q |
101 |
ctatctcagccaccaagaaattcacagatgcaaaagtaggcaccgaataaccatttaaaacaacctcttctgtcactctatgaggagcaacatagtgtaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
15176489 |
ctatctccgccaccaagaaattcacagatgcaaaagtaggcaccgaataaccatttaaaacaacctcttcggtcactctatgaggagcaacatagtgcaa |
15176588 |
T |
|
| Q |
201 |
cggtggatgccgtcttagcccttcc |
225 |
Q |
| |
|
||||||||| || |||||||||||| |
|
|
| T |
15176589 |
cggtggatgacgccttagcccttcc |
15176613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University