View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10047_low_21 (Length: 243)
Name: NF10047_low_21
Description: NF10047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10047_low_21 |
 | |
|
| [»] scaffold1075 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 17006250 - 17006016
Alignment:
| Q |
1 |
attatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttacct |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
17006250 |
attatgacgcaaaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttctagattggagggtcatcttttgtagattgcctcttgcct |
17006151 |
T |
|
| Q |
101 |
gtccnnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006150 |
gtccttttttt-ctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacc |
17006052 |
T |
|
| Q |
201 |
tttatgttttcaacctgttcaagaacttgatgtcca |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17006051 |
tttatgttttcaacctgttgaagaacttgatgtcca |
17006016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1075 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold1075
Description:
Target: scaffold1075; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 2847 - 3050
Alignment:
| Q |
1 |
attatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2847 |
attatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttgcct |
2946 |
T |
|
| Q |
101 |
gtccnnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2947 |
gtcc-tttttttctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacc |
3045 |
T |
|
| Q |
201 |
tttat |
205 |
Q |
| |
|
||||| |
|
|
| T |
3046 |
tttat |
3050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University