View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10047_low_24 (Length: 238)
Name: NF10047_low_24
Description: NF10047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10047_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 24633670 - 24633868
Alignment:
Q |
1 |
gaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgctagtgggataatgg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
24633670 |
gaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgctagtgagataatgg |
24633769 |
T |
 |
Q |
101 |
ctgttttggcattgacaacatccttagctgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgtaactgatgatg |
199 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
24633770 |
ctgttttggcattgacaacatccttaactgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgtaactgctgatg |
24633868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 52497085 - 52496887
Alignment:
Q |
1 |
gaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgctagtgggataatgg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
52497085 |
gaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgctagtgagataatgg |
52496986 |
T |
 |
Q |
101 |
ctgttttggcattgacaacatccttagctgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgtaactgatgatg |
199 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
52496985 |
ctgttttggcattgacaacatccttaactgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgtaactgctgatg |
52496887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University