View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_101 (Length: 335)
Name: NF10049A_low_101
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_101 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 10 - 329
Target Start/End: Complemental strand, 9985583 - 9985264
Alignment:
| Q |
10 |
aatataatttagggcctatcacaattttcttggcctatatggtagcctacaatataatatggacacaaattgtcacaaaaacttggtcactctagggaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9985583 |
aatataatttagggcctatcacaattttcttggcctatatggtagcctacaatataatatggacacaaattgtcacaaaaacttggtcactctagagaaa |
9985484 |
T |
|
| Q |
110 |
gacatggaacataaggtatacatgaagtgcataccccatttacatttttgcatgatgcatgaatttcctctcctatagaagatgttatgttaatcccttc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9985483 |
gacatggaacataaggtatgcatgaagtgcatactccatttacatttttgcatgatgcatgaacttcctctcctatagaagatgttatgttaatcccttc |
9985384 |
T |
|
| Q |
210 |
aagtataatgtttgtgcaagttatggcttcatcacaatgtaattgaattacatctttagcaatagatgttcctcttatgttgcggaaagttacatcactt |
309 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9985383 |
aagtataatgtttgtgcaagttatgtcttcatcacaatgtaattgaattgcatgtttagcaatagatgttcctcttatgttgcggaaagttacatcactt |
9985284 |
T |
|
| Q |
310 |
actttcactgcatatacact |
329 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
9985283 |
actttcactgcatatgcact |
9985264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University