View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_121 (Length: 315)
Name: NF10049A_low_121
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_121 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 6 - 177
Target Start/End: Original strand, 32907346 - 32907519
Alignment:
| Q |
6 |
acagagatgaatgaataaatcaatgaaaatcctgaaaaaatactctcactttat--cctatattatgagtgaaccaatcaataatcctcccattaattgt |
103 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
32907346 |
acagatatgaatgaataaatcaatgaaaatcctgacaaaatactctcactttatatcctatattatgtatgaaccactcaataatcctcccactaattgt |
32907445 |
T |
 |
| Q |
104 |
cactcctctcttgtatagcaaatcagcagaattgttggcttccctattcactcctctcttttgtattttctgtc |
177 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32907446 |
cactcctctcttggttagcaaatcagcagaattgttggcttccctgttcactcctctcttttgtattttctgtc |
32907519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 191 - 308
Target Start/End: Original strand, 32907580 - 32907697
Alignment:
| Q |
191 |
tgtagcatgtcttaaaacttaatatattaaaccttatatggagggtattctgccattggatggatttgcttccaggtaactgtaatgaaatactactggc |
290 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32907580 |
tgtagcatgtcttaaaacttaatgtattaaactttatatggagggtattcttccattggatggatttgcttccaggtaattgtaatgaaatactactggc |
32907679 |
T |
 |
| Q |
291 |
tttacactattgaaatct |
308 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
32907680 |
tttatactatcgaaatct |
32907697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University