View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_124 (Length: 310)
Name: NF10049A_low_124
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_124 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 7 - 302
Target Start/End: Original strand, 55075128 - 55075423
Alignment:
| Q |
7 |
gcttggtggaagagatggaaaaggccaccaaatttttctgtttttcaacccaagggataatctttaaagttgattgtgacttaacctttcacttggcaca |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075128 |
gcttggtggaagagatggaaaaggccaacaaatttttctgtttttcaacccaagggataatctttaaagttgattgtgacttaacctttcacttggcaca |
55075227 |
T |
 |
| Q |
107 |
tgaaagtccatgttatctctccccacaaatcctctcatcaagacaacacattgtaagataaagggccctgtgatatcatgatatcctctcttcacatgaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075228 |
tgaaagtccatgttatctctccccacaaatcatctcatcaagacaacacattgtaagataaagggccctgtgatatcatgatatcctctcttcacatgaa |
55075327 |
T |
 |
| Q |
207 |
gatgctaacctctactctatccagctagattagtcttctgttgtttggaattttaattgatattagtaattttgtgtggtttctaaaatattcttc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075328 |
gatgctaacctctactctatccagctagattagtcttctgttgtttgaaattttaattgatattagtaattttgtgtggtttctaaaatattcttc |
55075423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 73 - 152
Target Start/End: Complemental strand, 50371291 - 50371212
Alignment:
| Q |
73 |
aagttgattgtgacttaacctttcacttggcacatgaaagtccatgtta-tctctccccacaaatcctctcatcaagacaa |
152 |
Q |
| |
|
|||||||| ||||||| |||||||| ||||||||||||| |||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
50371291 |
aagttgatggtgactttacctttcatttggcacatgaaa-accatgttactctctccccacaattcttctcatcaagacaa |
50371212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University