View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_130 (Length: 306)
Name: NF10049A_low_130
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_130 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 25 - 291
Target Start/End: Original strand, 23853154 - 23853420
Alignment:
| Q |
25 |
atccttatttatgggaagcgactgaagcagtgctgaaagacgggtgggcacaacacaatcgtgacacaaccaacacaacttaaataggcatcccatttga |
124 |
Q |
| |
|
|||| |||||| |||||| ||||||||||| |||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
23853154 |
atccatatttaagggaagagactgaagcagagctgcaagtcgggtgggcacaacacaaccgtgacacaaccaacacaacttaaataggcatctcatttta |
23853253 |
T |
|
| Q |
125 |
ttatgtcctatcatttgttcatttttatatttggaacgagtcatgttgatgttctatttccgtgcatatcttgagcacttatttatatttggggacacct |
224 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23853254 |
ttatgtcctttcatttgttcatttttatatttggaacgagtcatgttgatgttctatttccgtgcatatcttgagcacttatttatatttggggacacct |
23853353 |
T |
|
| Q |
225 |
tatattcaaacacaattgagtctctatgtaattgaactctagttaattggtatctatgttgatgtcc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23853354 |
tatattcaaacacaattgagtctctatgtaattgaactctagttaattggtatctatgttgatgtcc |
23853420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University