View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_132 (Length: 304)
Name: NF10049A_low_132
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_132 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 269; Significance: 1e-150; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 6 - 298
Target Start/End: Complemental strand, 4822043 - 4821751
Alignment:
| Q |
6 |
aggtggtcctggcaggggcacaagcagctgccgatggcgggggtcgcgacgatggaagtattggataatacaatggtggtgctgattgcaggctgcaaag |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4822043 |
aggtggtcctggaaggggcacaagcagctgccgatggcgggggtcgcgacgatggaagtattggataatacaatggtggtgctgattgcaggctgcaaag |
4821944 |
T |
 |
| Q |
106 |
cttctttttcttcttatcacgagttcataatcagattgcttattttccaaaagtctagccatggagatataataataaataacaagtttaattttgatac |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4821943 |
cttcattttcttcttatcacgagttcataatcagattgcttattttccaaaagtctagccacggagatataataataaataacaagtttaattttgatac |
4821844 |
T |
 |
| Q |
206 |
accgtcaaagcaaacttttatacggctaaacaatcacaagtcacaaaacatcgttaattacgcaagaacttcatatacgtttcttcttctcag |
298 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4821843 |
accatcaaagcaaacttttattcggctaaacaatcacaagtcacaaaacatcgttaattacgcaagaacttcatatacgtttcttcttttcag |
4821751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 57 - 146
Target Start/End: Complemental strand, 4812010 - 4811922
Alignment:
| Q |
57 |
atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttatcacgagttcataatcagattgctt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4812010 |
atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttatcacgagttca-aatcagattgctt |
4811922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 4811893 - 4811820
Alignment:
| Q |
151 |
tccaaaagtctagccatggagatataataataaataacaagtttaattttgatacaccgtcaaagcaaactttt |
224 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4811893 |
tccaaaagtcaagccatggaaatataataataaataacaagtttaattttgatacaccgtcaaagtaaactttt |
4811820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 95 - 146
Target Start/End: Complemental strand, 4865435 - 4865385
Alignment:
| Q |
95 |
aggctgcaaagcttctttttcttcttatcacgagttcataatcagattgctt |
146 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4865435 |
aggctgcaaagcttcttttt-ttcttatcacgagttcataatcagattgctt |
4865385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 4865356 - 4865303
Alignment:
| Q |
151 |
tccaaaagtctagccatggagatataataataaataacaagtttaattttgata |
204 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
4865356 |
tccacaagtctggccatggaaatataataataaataacgagtttaattttgata |
4865303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University