View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_134 (Length: 301)
Name: NF10049A_low_134
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_134 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 281
Target Start/End: Complemental strand, 21832021 - 21831747
Alignment:
| Q |
7 |
taaattatactaataggatgcataatttcatgataatcagcattcgtctcttacatcaaatatggtatcaacaaaacaagttcatcttatagagatctca |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832021 |
taaatgatactaataggatgcataatttcatgataatcagcattcgtctcttacaccaaatatggtatcaacaaaacaagttcatcttatagagatctca |
21831922 |
T |
|
| Q |
107 |
tcaaccacatggagttcgaacttgaaataacctgaaaatacatttaaaataagcnnnnnnnnnnnnnctttgtagaccgataaaaacatcaatgaggaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21831921 |
tcaaccacatggagttcgaacttgaaataacctgaaaatacatttaaaataagcaaaaaaaaaaaaactttgtagaccgataaaaacatcaatgaggaca |
21831822 |
T |
|
| Q |
207 |
ttagatctcaaacatggtattaatggagtgatcaaataccacgatcgctttcgaggagggcacttggataccaag |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21831821 |
ttagatctcaaacatggtattaatggagtgatcaaataccacgatggctttcgaggagggcacttggataccaag |
21831747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University