View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_160 (Length: 286)
Name: NF10049A_low_160
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_160 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 5 - 197
Target Start/End: Complemental strand, 13879887 - 13879697
Alignment:
| Q |
5 |
ccaagaaaatctcactctgtcaactgtcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcatt |
104 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879887 |
ccaagaaaatctcact--gtcaactgttaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcatt |
13879790 |
T |
|
| Q |
105 |
cgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgagctg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13879789 |
cgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgccactccacgactcattcgctatttcaacaccaatgagctg |
13879697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 31 - 194
Target Start/End: Complemental strand, 13875640 - 13875477
Alignment:
| Q |
31 |
tcaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| ||| |||||| ||||||||||| || ||||||||| || |||| ||||||||||||| |
|
|
| T |
13875640 |
tcaacacaatggcattttcccgcctcctctcttcctgctaccgctcattcatggccgccgtgccttcactcattcgccgccaccccgtcgctactgccgc |
13875541 |
T |
|
| Q |
131 |
catgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgag |
194 |
Q |
| |
|
|||||| || || |||||||||||| | || |||| |||||||| ||||||||||||||||||| |
|
|
| T |
13875540 |
catgtcactcgtagccatctcctacaccgcacctccactcattcgctatttcaacaccaatgag |
13875477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 222 - 267
Target Start/End: Complemental strand, 13879675 - 13879630
Alignment:
| Q |
222 |
gatgatgatgatcttgttctctgggattttacggagactgaggagt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggagt |
13879630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 67
Target Start/End: Complemental strand, 13885756 - 13885720
Alignment:
| Q |
31 |
tcaacacaatggcattttcccgcctcctttcttcctc |
67 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
13885756 |
tcaacacaatggcattttcccgcttcctctcttcctc |
13885720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University