View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_181 (Length: 273)
Name: NF10049A_low_181
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_181 |
 | |
|
| [»] scaffold0907 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0907 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: scaffold0907
Description:
Target: scaffold0907; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 3815 - 4035
Alignment:
| Q |
1 |
tgagggaccgtgtttgttgaactttatgtgtgacaaagtgatctggaccgcaaatttttattgggaattggatgtataaataaatgtctgttaaggtatt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
3815 |
tgagggaccttgtttgttgaactttatgtgtgacaaagtgatctggaccgcaaatttttattgggaatgggatgtataaataaatgtttgttaaggtatt |
3914 |
T |
|
| Q |
101 |
aacatgatggccattggatcacgtgtacataaagaataatcagccttttttgagattggattttaacgtgttaggatattttcttactcgtgagtca-ca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
3915 |
aacatgatggccattggatcacgtgtacatcaagaataatcagccttttttgagattggattttaacgttttaggatattttcttactcgtgagtcataa |
4014 |
T |
|
| Q |
200 |
caaattaatttcgggtttctc |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4015 |
caaattaatttcgggtttctc |
4035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University