View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_184 (Length: 273)
Name: NF10049A_low_184
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_184 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 9 - 267
Target Start/End: Original strand, 27036335 - 27036599
Alignment:
| Q |
9 |
aacatagaccacatgtgttgttaaattccggaatagttagcacaactagtttgagttaaagaataaaaactccgaggttgcgagtttcaatcccttaatc |
108 |
Q |
| |
|
|||| ||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27036335 |
aacaaagaccacatgtgttgttcaaatccggaatagttagcccaactagtttgagttaaagaataaaaactccgaggttgcaagtttcaatcctttaatc |
27036434 |
T |
 |
| Q |
109 |
taacaatttgcgatttagnnnnnnnnnnnnnn----ttt--gtttctttttacaaaatatattcaattaatatacctcactcttcaaatgtgattgcatt |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27036435 |
taacaatttgcgatttagaaaaaaaaagaaagatattttccgtttctttttaaaaaatatattcaattaatatacctcactcttcaaatgtgattgcatt |
27036534 |
T |
 |
| Q |
203 |
gtgttgctgctattgtgaacatttctatttttgcaatgcatgatgaattcgaagcggcataaatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27036535 |
gtgttgctgctattgtgaacatttctatttttgcaatgcatgatgaattcgaagcggcataaatt |
27036599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University