View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_192 (Length: 267)
Name: NF10049A_low_192
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_192 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 8699875 - 8699769
Alignment:
| Q |
1 |
ggaatctcctacaagtcttgatttcaaatctagaagagttttgtgattcattgtgatgccttacccgacttaaggaattagtctatacactttgcacaaa |
100 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||| | |
|
|
| T |
8699875 |
ggaatctcctagaggtcttgatttcaaatctagaagagttttgtaattcattgtgatgccttacccgatttaaggaattagtttatacactttgcacaga |
8699776 |
T |
|
| Q |
101 |
gataccc |
107 |
Q |
| |
|
||||||| |
|
|
| T |
8699775 |
gataccc |
8699769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University