View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_201 (Length: 263)
Name: NF10049A_low_201
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_201 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 9631294 - 9631522
Alignment:
| Q |
15 |
aaactttaaagggaaatgatggaggatttatgatagtttcagtgttgtacttcactgaaaatgtagttttttaaatggaaagaaaaggaagattccatgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9631294 |
aaactttaaagggaaatgatggaggatttatgatagtttcagtgttgtacttcactgaaaatgtagttttttaaatggaaagaaaaggaagattccatgg |
9631393 |
T |
|
| Q |
115 |
tagcagaagaaggcagagcagtaaagcagtgtgacagacaccaaattggttttcaaaacttcaaatttagagaaacatgttgagagagagggtttgtact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9631394 |
tagcagaagaaggcagagcagtaaagcagtgtgacagacaccaaattggttttcaaaacttcaaatttagagaaacatgttgagagagagggtttgtact |
9631493 |
T |
|
| Q |
215 |
tgtagtgatagtaattgctatattggtatt |
244 |
Q |
| |
|
|||||||||||||| | ||||||||||||| |
|
|
| T |
9631494 |
tgtagtgatagtaa-tactatattggtatt |
9631522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University