View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_205 (Length: 261)
Name: NF10049A_low_205
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_205 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 49 - 239
Target Start/End: Original strand, 28678278 - 28678469
Alignment:
| Q |
49 |
tacagagcaatggcaaagcatattaatgtgtgtgtataaaagcataaaaacatagtagaggaattggaacacttatatacttgtatcgtgcatgtac-aa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
28678278 |
tacagagcaatggcaaagcatattaatgtgtgtgtataaaagcataaaaacatagtagaggaattggaacacttatatacttgtatcgtggatgtacaaa |
28678377 |
T |
 |
| Q |
148 |
attgaatgaaaaataagcattagtcgaagaggattgatgaaaaatagttctggaaacacagatttgaattcatcaatttaataggtcaatgt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28678378 |
attgaatgaaaaataagcattagtcgaagaggattgatgaaaaatagttctggaaacacagatttgaattcataaatttaataggtcaatgt |
28678469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University