View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_207 (Length: 261)
Name: NF10049A_low_207
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_207 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 131 - 249
Target Start/End: Complemental strand, 24130246 - 24130127
Alignment:
| Q |
131 |
taagttacgaaagtaaggtgatgccgtaaaatgacacactttcattgaattta-gtgtaaagttgatttacaatgacagtatttgtccttgaaatctaat |
229 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24130246 |
taagttacaaaagtaaggcgatgccgtaaaacgacacactttcattggatttaagtgtaaagttgatttacaatgacagtatttgtccttgaaatctaat |
24130147 |
T |
|
| Q |
230 |
ttttatttctttgatatatt |
249 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24130146 |
ttttatttctttgatatatt |
24130127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 38 - 134
Target Start/End: Complemental strand, 24130978 - 24130882
Alignment:
| Q |
38 |
ttgtgttgtttttcgcatgacccatgaactccccaacatgtatctaatgtccatgcacttagtatttcagttgtacttacgggaccttgcttataag |
134 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24130978 |
ttgtgttgtttgtcgcttgacccatgaactccccaacatgtatctaatgtccatgcacttagtatttcagttgtacttacgggaccttgtttataag |
24130882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University