View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_212 (Length: 258)
Name: NF10049A_low_212
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_212 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 36 - 244
Target Start/End: Complemental strand, 41979389 - 41979181
Alignment:
| Q |
36 |
tggcaaagtatcaatttccgccgcgtatctcatattgattgctaatgattctcataccgcaacagttatggattcctagcaaaggactatgaaaggaggt |
135 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41979389 |
tggcaaagtatcaatatccgccgtgtatctcatactgattgctaatgattctaataccgcaacagttatggattcctagcaaaggactatgaaaggaggt |
41979290 |
T |
|
| Q |
136 |
caattatccatgatcggttagatattgttacatacctgatcatcggtagacttgacacaatctggatggttttcctgcaaagtgtcactaacagggccaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41979289 |
caattatccatgatcggttagatattgttacatacctgatcatcagtagacttgacacaatctggatggttttcatgcaaagtgtcactaacagggccaa |
41979190 |
T |
|
| Q |
236 |
tgatgtcca |
244 |
Q |
| |
|
| ||||||| |
|
|
| T |
41979189 |
taatgtcca |
41979181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University