View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_233 (Length: 250)
Name: NF10049A_low_233
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_233 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 32103698 - 32103469
Alignment:
| Q |
13 |
gttttagatatgattaaatattgcagagaaatgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggcggctccatctccattaggcagta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32103698 |
gttttagatatgattaaatattgcagagaaatgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggctgctccatctccattaggcagta |
32103599 |
T |
|
| Q |
113 |
agcttcaaaacatgttgcaggctgcggtgcaatctgttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103598 |
agcttcaaaacatgttgcaggctgcggtgcaatctgttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttctt |
32103499 |
T |
|
| Q |
213 |
ttcctcttcctcactcactatatattcttc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32103498 |
ttcctcttcctcactcactatatattcttc |
32103469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University