View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_242 (Length: 249)
Name: NF10049A_low_242
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_242 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 2727939 - 2727695
Alignment:
| Q |
7 |
tttggtgtttatcctatggatacaaattggggagttgcattgcttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727939 |
tttggtgtttatcctatggatacaaattggggagttgcaatacttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
2727840 |
T |
 |
| Q |
107 |
ggacatctagaaataattctgttggtggccctaacttgccatttggtttaggaaggtatgaattgtagcacgtgaaacttcc--ataactataaggatct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
2727839 |
ggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttccatataactataaggattt |
2727740 |
T |
 |
| Q |
205 |
aattccgtatatgcaccgatagtgtaaagattttttatactgtca |
249 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2727739 |
aattccgtatatgcaccgacagtgtaaagattttttatactgtca |
2727695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University