View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_255 (Length: 246)
Name: NF10049A_low_255
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10049A_low_255 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 22362307 - 22362097
Alignment:
Q |
17 |
gattattctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatct- |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
22362307 |
gattattctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatatt |
22362208 |
T |
 |
Q |
116 |
--tgctgggttcttattcatcttttctttttcatgcgttgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagaatataccat |
213 |
Q |
|
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
22362207 |
gctgctgggttcttattcatcttttctatttcatgcattgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagagtataccat |
22362108 |
T |
 |
Q |
214 |
agtattaagag |
224 |
Q |
|
|
||||||||||| |
|
|
T |
22362107 |
agtattaagag |
22362097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University