View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_263 (Length: 245)
Name: NF10049A_low_263
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_263 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 32558998 - 32558897
Alignment:
| Q |
1 |
atatatattttacatatccctaatttctcccatcatttgaaactcatctctcatgcaaaactaatagccattccttacaaagggtagaagaaatacatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32558998 |
atatatattttacatatccctaatttctcccatcatttgaaactcatctctcatgcaaaactaatagccattccttacaaagggtagaagaaatacatgg |
32558899 |
T |
 |
| Q |
101 |
ac |
102 |
Q |
| |
|
|| |
|
|
| T |
32558898 |
ac |
32558897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 32558852 - 32558776
Alignment:
| Q |
147 |
gtatatagttttacgtgatgaaatatttgaagagtcagtgatggattctgttgctcagtacccttgatagttctttt |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32558852 |
gtatatagttttacgtgataaaatatttgaagagtcagtgatggattctgttgctcagtacccttgatagttctttt |
32558776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University