View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_268 (Length: 244)
Name: NF10049A_low_268
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_268 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 244
Target Start/End: Complemental strand, 54608297 - 54608066
Alignment:
| Q |
21 |
aaattctagttcttgcaggatcatcctaatataataaataaataaat--------tgtagttttcagtagccagtataaagtttggggcatggagaagtc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608297 |
aaattctagttcttgcaggatcatcctaatataataaataaataaataaataaactgtagttttcagtagccagtataaagtttggggcatggagaagtc |
54608198 |
T |
 |
| Q |
113 |
tcttgttaattgccatccatatatctcccttggaccttggtccacttgcaagttgcaaatgatcggtacccagattcatacctagccttctctcttctta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608197 |
tcttgttaattgctatccatatatctcccttggaccttggtccacttgcaagttgcaaatgatcggtacccagattcatacctagccttctctcttctta |
54608098 |
T |
 |
| Q |
213 |
aataccaataccaatctagcgcagcacatttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54608097 |
aataccaataccaatctagcgcagcacatttt |
54608066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University