View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_270 (Length: 244)
Name: NF10049A_low_270
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_270 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 36970896 - 36971102
Alignment:
| Q |
20 |
acagatatcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaactctgtcgcacattcttgc |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36970896 |
acagatatcgtccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaattctgtcgcacattcttgc |
36970995 |
T |
|
| Q |
120 |
atcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctacccacattcgctatgggcaacgttttatctccttcat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36970996 |
atcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctacccacattcgctatgggcaacgttttatctccctcat |
36971095 |
T |
|
| Q |
220 |
cgttcat |
226 |
Q |
| |
|
||||||| |
|
|
| T |
36971096 |
cgttcat |
36971102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 82
Target Start/End: Original strand, 39786325 - 39786381
Alignment:
| Q |
26 |
atcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacc |
82 |
Q |
| |
|
|||||| ||||| || |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39786325 |
atcatcaccattcactgtcttgcgcttctccttgtgacacttgtcagatgcttcacc |
39786381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 122
Target Start/End: Complemental strand, 56068049 - 56067978
Alignment:
| Q |
51 |
ttctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaactctgtcgcacattcttgcatc |
122 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||| | ||| ||||||||||||| |||| ||||||||| |
|
|
| T |
56068049 |
ttctctttctgacacttttcagatgcttcacctgttatgaagcttatgaactctgatacacactcttgcatc |
56067978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University