View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10049A_low_278 (Length: 243)

Name: NF10049A_low_278
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10049A_low_278
NF10049A_low_278
[»] chr5 (1 HSPs)
chr5 (36-148)||(42590891-42591004)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 36 - 148
Target Start/End: Complemental strand, 42591004 - 42590891
Alignment:
36 caccagcttgtattacagttagaaattatctttaaccacactattccatagg-gaatgcccttcttcaattctgttatcaccactatgctcactacccaa 134  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
42591004 caccagcttgtattacggttagaaattatcttcaaccacactattccataggagaaggcccttcttcaattctgttatcaccactatgctcactacccaa 42590905  T
135 tatgattgccatta 148  Q
     |||| ||||||||    
42590904 catgactgccatta 42590891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University