View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_278 (Length: 243)
Name: NF10049A_low_278
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_278 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 36 - 148
Target Start/End: Complemental strand, 42591004 - 42590891
Alignment:
| Q |
36 |
caccagcttgtattacagttagaaattatctttaaccacactattccatagg-gaatgcccttcttcaattctgttatcaccactatgctcactacccaa |
134 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42591004 |
caccagcttgtattacggttagaaattatcttcaaccacactattccataggagaaggcccttcttcaattctgttatcaccactatgctcactacccaa |
42590905 |
T |
 |
| Q |
135 |
tatgattgccatta |
148 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
42590904 |
catgactgccatta |
42590891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University