View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_284 (Length: 242)
Name: NF10049A_low_284
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_284 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 6236580 - 6236348
Alignment:
| Q |
1 |
ttgatgtaattctgccttttctgtttttgtttcttcctgatgtagaccttgttatgggttctggccctctctagttttattgaatttcttcgcttgatcn |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6236580 |
ttgatgtaattctgccttttctatttttgtttcttcctgatgtagactttgttatgggttctggccctcttcagttttattgaatttcttcgcttgat-a |
6236482 |
T |
|
| Q |
101 |
nnnnnnnnnnnnttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6236481 |
aaaaaaaaaaaattagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttg |
6236382 |
T |
|
| Q |
201 |
ttgaatgtgggaacactataatttagaaacacca |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
6236381 |
ttgaatgtgggaacactaaaatttagaaacacca |
6236348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 113 - 218
Target Start/End: Original strand, 33891807 - 33891908
Alignment:
| Q |
113 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
212 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33891807 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33891902 |
T |
|
| Q |
213 |
acacta |
218 |
Q |
| |
|
|||||| |
|
|
| T |
33891903 |
acacta |
33891908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 113 - 218
Target Start/End: Complemental strand, 33952441 - 33952340
Alignment:
| Q |
113 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
212 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33952441 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33952346 |
T |
|
| Q |
213 |
acacta |
218 |
Q |
| |
|
|||||| |
|
|
| T |
33952345 |
acacta |
33952340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University