View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_289 (Length: 241)
Name: NF10049A_low_289
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_289 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 3790340 - 3790132
Alignment:
| Q |
19 |
aggaataggagcaaatagtcatatttctcaacaagnnnnnnnntaaactcatcatctcaattaaaacttatctcgcttatgattattctaatttgttttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790340 |
aggaataggagcaaatagtcatatttctcaacaaggaaaaaa-taaactcatcatctcaattagaacttatctcgcttatgattattctaatttgttttc |
3790242 |
T |
|
| Q |
119 |
aattaatctgttgagtatgactactcatagacacatacgaggggaagggcgaggaaggtgatcatctagcatggcattgcgaagctcccttcaactttag |
218 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790241 |
aattaatttgttgagtatgactactcatagacacataagaggggaaggaagaggaaggtgatcatctagcatggcattgcgaagctcccttcaactttag |
3790142 |
T |
|
| Q |
219 |
agatattgtt |
228 |
Q |
| |
|
| ||||||| |
|
|
| T |
3790141 |
atctattgtt |
3790132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University