View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_293 (Length: 240)
Name: NF10049A_low_293
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_293 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 32 - 160
Target Start/End: Complemental strand, 50509288 - 50509162
Alignment:
| Q |
32 |
ttacataaatactaaaggtacattttgtttgctacatcttttaaaaacattttcaaaatactatatgaattgaattatttttagaatnnnnnnncaaaat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50509288 |
ttacataaatactaaaggtacattttgtttgctacatcttttaaaaacattttcaaaatactatatgaattgaattatttttagaat--aaaaacaaaat |
50509191 |
T |
 |
| Q |
132 |
agatttacctcttcttttttaactgtagg |
160 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
50509190 |
agatttacctcttcttttttcactgtagg |
50509162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 184 - 227
Target Start/End: Complemental strand, 50509132 - 50509089
Alignment:
| Q |
184 |
gctttctgtgcctgatcttttttgatagcatcatctagcctatc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
50509132 |
gctttctgtgcctgatcttttttgatagcatcaactagcatatc |
50509089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 93 - 240
Target Start/End: Original strand, 10782614 - 10782758
Alignment:
| Q |
93 |
tatatgaattgaattatttttagaatnnnnnnncaaaatagatttacctcttcttttttaactgtaggtgatggcccttccnnnnnnnnnngctttctgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
10782614 |
tatatgaattgaattatttttagaataaaaa--caaaatagatttacctcttcttttttcactgtaggtgaaggcccttccttttttttgt-ctttctgt |
10782710 |
T |
 |
| Q |
193 |
gcctgatcttttttgatagcatcatctagcctatcatcatattgtcta |
240 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
10782711 |
gcctgatcttttttgatagcatcaactagcatatccacatattgtcta |
10782758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University